"sed" ("stream editor") is a Unix utility that parses and transforms text files.

learn more… | top users | synonyms

2
votes
1answer
44 views

sed, insert file before last line

The following inserting file method for sed used to be working, even before last line, but not any more. Is it a bug in the current sed? Demo of inserting file method with sed: mkdir /tmp/test ...
1
vote
1answer
21 views

Run sed as a one-off ssh command

I would like to substitute a string with another in a file on a server of mine. I've tried doing this: ssh $REMOTE_HOST sed 's|export ${KEY}=${VAL}|export ${KEY}=${NEW_VAL}|' "$ENV_FILE" And a ...
3
votes
3answers
40 views

Sed replace only in even numbered lines of a file when replace commands are written in a file

I have all the replace commands in a file (say replace.sed) and i use it with -f flag of sed (sed -f replace.sed InputFile). But now i ran into a condition where i need to apply these replace rules ...
1
vote
2answers
295 views

Skype: Decode time stamps

I'm trying to extract the chat history between myself and my SO on Skype for OSX. I've managed to pull out the information and strip out the unnecessary XML formatting with the following command: ...
0
votes
1answer
20 views

Replace negative values in a file with zeros

I want to replace all negative values in a file with zeros. How can I do this in awk? I tried with gsub but gsub(-*, 0) doesn't work... Any ideas? My "code" is awk '{gsub($(!/-/),"0",$2); print $1 ...
0
votes
0answers
23 views

delete all values in a .csv file besides the name “EC_Customers” and “EC_Leads”

I have a .csv file that has a column for contact tags. In this column, I have a whole bunch of separated tags. I want to delete all of the tags besides "EC_Customers" and "EC_Leads" How do I go ...
25
votes
10answers
13k views

How to Remove the Last 2 Lines of a Very Large File

I have a very large file ~400G, and I need to remove the last 2 lines from it. I tried to use sed, but it ran for hours before I gave up. Is there a quick way of doing this, or am I stuck with sed?
1
vote
0answers
13 views

Non case sensitive search case sensitive replace

How do I search/and replace like this using sed or another tool FOO => BAR Foo => Bar foo => bar That is: Look for foo regardless of case, and replace with the same case pattern. One ...
59
votes
4answers
66k views

How to match whitespace in sed?

How can I match whitespace in sed? In my data I want to match all of 3+ subsequent whitespace characters (tab space) and replace them by 2 spaces. How can this be done?
0
votes
2answers
91 views

Installation of Git on Debian 7.4 fails

I tried to install Git (from source) on Debian 7.4, but the installation fails with the following message: Writing perl.mak for Git Writing MYMETA.yml * new perl-specific parameters GEN ...
0
votes
2answers
2k views

Why escaped single quote doesn't work in grep?

I am trying to match a string: * * * * * /usr/local/bin/growlnotify -t 'helloTitle' -m 'helloMessage' -n 'myApp' -sw with: crontab -l | grep '^[^#].*/usr/local/bin/growlnotify.*\-n \'myApp\'.*$' ...
0
votes
0answers
8 views

How to colorize the output using sed - no GNU tools available

I'm using a short alias in my .profile file to colorize the output of the sdiff command, just to make it easier to spot differences. The alias is like this: alias color_diff="sed 's/[|< |> ...
0
votes
1answer
26 views

How to replace a line in an xml file with a set of lines stored in a variable or file using unix commands?

I have a xml file in which the line that needs to be searched is: SEARCH='<?xml version="1.0" encoding="UTF-8" standalone="no"?><SSC>' This searched value needs to be replaced with ...
0
votes
1answer
15 views

Escape brackets when using SED

I would like to replace the value varchar(36) with char(36) in a file by using sed. I am trying with sed -i ’s/varchar(36)/char(6)/g’ calls_contacts.sql But the command does not execute. What am I ...
10
votes
6answers
3k views

Removing ANSI color codes from text stream

Examining the output from perl -e 'use Term::ANSIColor; print color "white"; print "ABC\n"; print color "reset";' in a text editor (e.g., vi) shows the following: ^[[37mABC ^[[0m How would one ...
1
vote
4answers
930 views

Batch renaming of files using regular expression in Unix

I have several thousand files of the form: [8-digit number]_[number I want]_S60491_I129111.dcm. I wish to remove everything except the number I want, and use that as its name. In Ruby, I can get to ...
1
vote
2answers
32 views

Adding text to the end of multiple files, minus one line( Adding return 0; at the end of each program in C)

I have a bunch of C programs from K&R and of course, no return statement. I was wondering if there was a way to cat to the end of each file (except one line before the end, so EOF - 1) the ...
2
votes
2answers
56 views

sed error when launching terminal on OS X

I get these error messages when launching bash or zsh in standard Terminal.app or iTerm2 sed: 1: "\#^system_type=# { s#^s ...": extra characters at the end of p command sed: 1: "\#^system_type=# { ...
0
votes
0answers
25 views

How to call “sed” on PDF files

I am able to find text on PDF files using pdfgrep. How can I sed them? I just want to change a pattern of text and I don't think I need a editor for that. Or do I? How can I achieve that?
0
votes
1answer
24 views

How to use sed to examine the line without specific content?

I made a toy file named toy, its content is like: aaa bbb My first idea is to use: sed -n '/[^a]/ p' toy bbb it prints out bbb, but when I added bb ab to the end of toy file. I found it lose ...
0
votes
1answer
433 views

Sed pattern for multiple lines

I want to remove all create table statements from a mysql script, but the statement runs over multiple lines. Like this: Create table ......NEWLINE... NEWLINE... NEWLINE....; So I tried this ...
0
votes
1answer
142 views

Find a pattern in a line, and append that matched pattern to the same line

I'm trying to pull a job number out of notes listed in a csv, and then append that number to the end of the line, preferably through sed, awk, grep or perl (which I have installed in Cygwin. Here's a ...
-1
votes
2answers
54 views

add line number after matched pattern in vim

I have raw sequences and I have to convert it to fasta format. so reads are like this: CTACGGTGTGCTCTTCCGATCTGACTATG AGTTGGTGTGCTCTCCCGATCTCGCTCCCTC GTGAGGTGTGCTCTTCCGATCTCCGGCAGTGTGCT and i want ...
4
votes
2answers
50 views

shell script to replace a keyword in a file with the contents of another file

I'm to create a .sh to replace a specific keyword in a file using the contents of an other file. template.html contains a unique string "PLACEHOLDER" it must be replaced with the contents of file ...
2
votes
4answers
47 views

Extract lines based on long list of line numbers

I have a long list of line numbers (35389208) that I do not want in my file. By line number I mean the line in my file (e.g. line 277). My list of line numbers I do not want looks like: 277 278 279 ...
3
votes
1answer
56 views

Using sed with parallel gives empty output when redirecting to file

I'm using the zsh shell. I am trying to use sed to substitute some text in many files, using parallel to speed up the process. When I tested this on one file and let the command output go to stdout I ...
1
vote
1answer
79 views

Apache as Proxy replace the html code/tags/text

I configured my apache2 server as a proxy server. I added some filters to my proxy.conf file to change the text (html source code) of the websites. Example code: ExtFilterDefine foodo mode=output ...
2
votes
4answers
5k views

Using sed get substring between two double quotes

I have a file xyz... rsync: "/home/path/to/file": Permission denied (13) rsync: "/home/path/to/file1": Permission denied (13) rsync: "/home/path/to/file2": Permission denied (13) rsync: ...
0
votes
1answer
37 views

using sed to replace 1 line with a multi-line variable in ksh

I have the following text in a file: XXXX NNNN YYYY NNNN ZZZZ NNNN I want to replace the NNNN to make it look like this: XXXX NNNN DUTY FORECASTER: YYYY NNNN DUTY FORECASTER: ZZZZ NNNN ...
0
votes
2answers
82 views

Properly escaping forward slash in bash script for usage with sed

I'm trying to determine the size of the files that would be newly copied when syncing two folders by running rsync in dry mode and then summing up the sizes of the files listed in the output of rsync. ...
0
votes
1answer
36 views

GnuWin32 sed how can I search and replace quotes? Win7 UK

Getting really weird behaviour with sed in Win7: Manual says surround substitute command with single quote (') - rejects, only allows double quote ("). Plus I want to change double quote in a file to ...
0
votes
2answers
48 views

Search, match and replace 1st column with a value using sed

I would like to get some advice using sed on how to replace value1 on first column that matches with value2: value1 = 9999 value2 = 02a-ResetFlag.sh Data File ---------------------------------- 0500 ...
1
vote
2answers
59 views

Replacing every 10th pipe with new line in unix

Lets say I have fields: name, number, id I have a data file: name1|number1|id1|name2|number2|id2...etc I want to replace every 3rd pipe with a new line or '\n' so I get: name1|number1|id1 ...
1
vote
2answers
37 views

How do I print multiple sections in a text file?

I have a text file looking something like this: *FILESTART line_a line_b line_c *INCLUDE file_A.key file_B.key *INCLUDE file_1.key file_2.key file_3.key *SOMETHING_ELSE line_x line_y line_z *END I ...
0
votes
1answer
34 views

Filtering data with sed

I need a help. I have a file like sometext line 1 sometext line 2 SU0000 ID ID ID sometext line 3 sometext line 4 sometext line 5 sometext line 6 SU0000 ID ID ID sometext line 7 sometext line 8 ...
1
vote
1answer
20 views

Print every line but conditionally only fragments for some lines

I have a text file that looks like this: rno-miR-344-5p miRPlus_11239/mmu-miR-383/rno-miR-383 hsa-miR-301a/mmu-miR-301a/rno-miR-301a ...
2
votes
4answers
2k views

Print line X lines before/after found line

I want to search for a particular string in a certain file. If I found the string, I also want to print the line X lines before (or after) that line. Can this with grep or awk, or do I need a ...
6
votes
7answers
6k views

List only the device names of all available network interfaces

I want to get a list of all available Network-Device Names on my Linux server. I figured that netstat -a would do the job, however netstat produces quite much output: eth0 Link encap:Ethernet ...
2
votes
2answers
3k views

use sed to replace nbsp, 160, Hex 00a0, Octal 240, non-breaking space

I am having some problems with config files which have the non-breaking space chars in them. How should I specify that character with sed so I can replace it with a space. sed -n 's/ / /g' ...
0
votes
3answers
249 views

How to use sed or AWK to separate a string (NOT string in files)

How can I separate .sh files into a list? I have tried: ls *.sh | xargs sed 's/\n/ /g' > out.txt The return of ls *.sh is a long string with '\n' in the middle.
0
votes
0answers
30 views

Tmux status sed output different from cli

I've been looking at this for a while now, but I cannot find a reason. When I run the following in a cli, it works as expected: $ uptime | sed "s/.*average: \(.*\), \(.*\), \(.*\)$/\1 \2 \3/g" 0.65 ...
0
votes
1answer
47 views

SED: syntax error at script.pl line 19, near “;$'”

I am using this command to delete multiple occurrences of a line in my script and it just works fine when I run it on the command prompt. However when I use this line in my perl script it throws an ...
0
votes
1answer
63 views

Regexp based editing of content in large CSV files [duplicate]

I wanted to remove certain pattern of contents based on a regex from csv file which is very large in size containing 100,000+ records, how is it possible via windows commandline? I also have sed and ...
0
votes
2answers
38 views

Removing Nested LaTeX Tags with Regex

How would I use regex (such as with sed) to remove all \index tags that occur inside any \index tags? For example, a nested mess like this: \index{Test\index{test\index{test}}ing One\index{one} ...
2
votes
1answer
75 views

Use perl to do multi-line replacement [closed]

I have to do some replacements in many *.c files. I want to do the replacement like this: original: printf("This is a string! %d %d\n", 1, 2); result: print_record("This is a string! %d %d", 1, 2); ...
0
votes
1answer
20 views

Replace '-' char using sed

I have a text file, quite similar to this one: JACK BLACK 123456 -1245368 - BRIDGET RED 1245 548425 + JOHNNY HOMUSS 55482 -4325 - I wanted to use a sed command ...
1
vote
1answer
67 views

Zsh autocomplete function with sed

I'm struggling to write an ZSH autocomplete function. My goal is to autocomplete ta's and tk's first argument with the projects listed in tmux list-sessions and tmuxinator list. Here's what I have so ...
0
votes
1answer
27 views

Sed is not Interpreting Pipes Correctly

OK, this is hard to explain, so I will give a reproducible example: I have a text file test.txt contains the line: somesetting-parameter /an/old/path I want to replace it with a path I can get via ...
-2
votes
2answers
51 views

Trying to count and print song file names using awk

RANK NAME BAND YEAR GENERE DOMESTIC/INTERNATIONAL 206:Reach Out, I'll Be There:The Four Tops:1978:Pop:3/2 207:Bye Bye Love:The Everly Brothers:1950:Classic:3/2 ...
8
votes
2answers
8k views

How can I make a table of contents for a markdown document with Python/AWK/SED?

I have the following markdown document: Heading-a ========== ---text--- Heading-b ------------ --- text --- Heading-c ---------- --- text--- Heading-d ======= --- text---- Heading-e --- ... ...